ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
Olig1 (Olig Family Transcription Factor)
Oligo, Random Primer 6 Hexamer
OLIGREEN(TM) SSDNA
OLII
OKTAKIS-(6-O-TERTBUTYL-DIMETHYLSILYL-G-CYCLODEXTRIN
OKTAKIS-(2,6-DI-O-TERT-BUTYL-DIMETHYLSILYL)-GAMMA-CYCLODEXTRIN C144H304O40Si16
OLIQUINDOX
OLIVAMIDE DEA 124046-30-6
OLIVAMIDOPROPYL DIMETHYLAMINE
OLIVAMIDOPROPYL DIMETHYLAMINE LACTATE 124046-31-7
OLIVAMIDOPROPYLAMINE OXIDE 124046-32-8
OLIVAMIDOPROPYLTRIMONIUM CHLORIDE
OLIVAMIDOPROPYL BETAINE
OLIVE FRUIT STANDARDS KIT
OliveLeafP.E.4:1,OleaEuropea
OLIVE OIL PEG-8 ESTERS
OliveExtract
OliveLeafExtract20Oleuropein
OLIVE LEAVES (OLEA EUROPEA)
Olive leaf Ext
OLIVE OIL PEG-7 ESTERS
Olive leaf PE
Olive oil 8001-25-0
Olivetol 500-66-3 C11H16O2
OliveLeafPowder,OleaEuropea
OliveLeafP.E.10:1,OleaEuropea
OLIVE(OLEAEUROPAEA)HUSKOIL
OLIVE FLAVOUR
OliveOilVirgin
OliveLeafS.E.12,OleaEuropea
OLIVE LEAF EXTRACT
OliveLeafS.E.6,OleaEuropea
OliveLeafS.E.10,OleaEuropea
OLIVELEAFPOWDOWEXTRACT
OLIVE OIL POLYGLYCERYL-6 ESTERS
Olive leaves (olea europea) (trace elements),
OLIVE OIL PEG-6 ESTERS 103819-46-1
OliveLeafS.E.18,OleaEuropea
Olive Leaf
OLIVEAMIDE MEA
OLIVE LEAF(OLEUROPEIN) HPLC ANALYSIS KIT
Olive Leaf Extract, Powder, 10 Oleuropein
Olivine
Olivomycin 6988-58-5
OLIVOYL HYDROLYZED WHEAT PROTEIN
Omadine TBAO 33079-08-2
Oktober 03 IgM Test Kit
Oktober 03 IgA Test Kit
OMALIZUMAB 242138-07-4
2'-O-MB-CAMP SODIUM SALT 55443-13-5 C14H17N5NaO7P
6''-O-MALONYLGLYCITIN 137705-39-6 C25H24O13
6"-O-MALONYLDAIDZIN, 98+ C24H22O12
6''-O-MALONYLGENISTIN 51011-05-3 C24H22O13
6"-O-MALONYLGLYCITIN, 98+ C25H24O13
6"-O-MALONYLGENISTIN, 98+ C24H22O13
6''-O-MALONYLDAIDZIN 124590-31-4 C24H22O12
2'-O-MB-CGMP SODIUM SALT 58329-72-9 C14H17N5NaO8P
6-O-Maltosyl-¦Â-cyclodextrin
6-O-MALTOSYL-BETA-CYCLODEXTRIN C126H210O105
6-O-(maltosyl)cyclomaltohexaose 100817-30-9 C26H34O6
O/M-Anisaldehyde C8H8O2
O-mannopyranosyl-1-4-O-2-amino-2-deoxyglucopyranosyl-1-6-myo-inositol 1-(1,2-di-O-myristoyl-sn-glycer-3-yl hydrogen phosphate) 146076-25-7
OMAPATRILAT 167305-00-2 C19H24N2O4S2
omasun semicooked natural
Olmesartan 144689-78-1 C24H26N6O3
Olmesartan 144689-24-7 C24H26N6O3
OlmesartanEthyl-4-(1-Hydroxy-1-Methylethyl)-2-Propyl-1-{4-[2-Trityltetrazol-5-Yl)Phenyl]Phenyl}Methylimidazole-5-Carbxylate(TritylOlmesartan)
Olmesartan-d4 C24H22N6O3D4
OlmesartanMedoxamil
CS-866 144689-63-4 C24H26N6O3
Ombrabulin 181816-48-8 C21H26N2O6
Olmidine 22693-65-8 C9H10N2O3
OMBUIN(P)
Ombuoside 20188-85-6 C29H34O16
OMBUOSIDE C29H34O16
2 -OME-A
2 -OME A (B2) DMT
2 -OME A PNS
O'MEARA'S REAGENT
2 -OME-C
OMDM-1 C27H45NO3
OMDM-2 C27H45NO3
2 -OME C (AC) DMT
5'-2'-OME(CUGGAUCCAAGGCUGUAGGU)-3', SODIUM SALT
5'-2'-OME(CUGGUUACACGACUCCAGGU)-3', SODIUM SALT
2 -OME-G
OmegawaxTM Column Test Mix
OMEGA CHROME BROWN EB
OMEGA-CONOTOXIN GVIA 106375-28-4 C120H182N38O43S6
OMEGA-3-OILS
OMEGA-TRANSAMINASE VF, VIBRIO FLUVIALIS, RECOMBINANT 9030-47-1
OMEGA-CONOTOXIN SVIB 150433-82-2 C105H176N38O36S6
Omega3-Methyl?Arachidonate?(8c,?11c,14c,?17c?)
OMEGA-AMINOPROPYL RESIN C3H9N2R
OMEGA-BENZOYLOXY RESACETOPHENONE C15H12O5
OMEGA,OMEGA'-DIBROMO-O-XYLENE
OMEGA-3-FETTSREN
OMEGA-3- ENCAPSULATED WATER SOLUBLE POWDER
OmegawaxTM
OMEGA-AMINOHEXYL RESIN C6H15N2R
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

Copyright 2007©  ChemicalBook. All rights reserved.