ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
G-(2-FURYL)PROPANOL-1 C7H10O2
GHCA 51820-24-7 C14H22N6O5S
GHCA(INTERMEDIATE FOR CEFTIBUTEN, CEFTIZOXIME)
GHATTI GUM 9000-28-6
G-GLOBULIN, BOVINE, FRACTION II
GH, BOVINE
GHB(RG) 30382-24-2 C11H14N2O4
500 G GLYCINEANALYTICAL GRADE C2H5NO2
[G-3H]7,12-DIMETHYLBENZ[A]ANTHRACENE C20T16
GF109203X
CAS:133052-90-1
SN-978
GHCA
GGNYVHLPLSPRTLNAWVKL C104H163N29O26
GGNYVHLPLSPRTLN C73H116N22O21
G-HESPERIDIN
G-HEXABROMOCYCLODODECANE C12H18Br6
GH, HORSE
GGTACC, 5'-NON-PHOSPHORYLATED C58H74N23O39P5
GGTACC, 5'-PHOSPHORYLATED C58H75N23O42P6
5'-GGTAGCCATCCTGGCACT-3', SODIUM SALT
GGTASE-II
GGTASE I
GGTase Substrate, Fluorogenic
GGTase II, Rat, Recomb.
5'-GGTCGCCATCAGGTCACT-3', SODIUM SALT
5' GGTCTATATAAGCAGAGCTGGT 3'
GGTI-286 C25H30F3N3O4S
GHK C14H24N6O4
GGTI-298 C29H34F3N3O5S
GGTI-287 C24H28F3N3O4S
GGTI-297 C26H31N3O3S
Gg-1-Sub,His*Tag,Recomb.
G-g-3-Sub,His*Tag,Recomb.
Gg-5-Sub,His*Tag,Recomb.
Gg-2-Sub,His*Tag,Recomb.
Gg-7-Sub,His*Tag,Recomb.
g GT, kinetic, soluble substrate
GHKARVLAEAMSQVT C67H116N22O21S
Ghk-Cu
GHK-Cu£¬ GHK COPPER
GhkGlpPeptide
Gia/Gq-Subunit Chimera Rat, Recombinant
GGTTTAAACC, 5'-PHOSPHORYLATED
GGTTTAAACC, 5'-NON-PHOSPHORYLATED
Gibberellic acid 77-06-5 C19H22O6
gibberic acid 427-78-1
GibberellicAcid85&90
GibberellinsA4+7TechnicalGa4+7Agrochemical
GibberellinA4+7(Ga4+7)90Min.
Gibberalicacid
Gibberellin A4 468-44-0 C19H24O5
GibberellinA4+7(Ga4+7)
gibberellin A12 aldehyde 19436-07-8
Gibberellin A7 510-75-8 C19H22O5
GIBBERELLIC ACID POTASSIUM SALT 125-67-7 C19H21KO6
GibberellinA4+7(Ga4+7)Ga4:468-44-0
gibberellin A12 1164-45-0
Gibberellin I 15355-41-6
Gibberellins A4+7 technical
GIBBERELLIN A7 C19H22O5
GIBBERELLIC ACID(RG)
Gibberellin A4+7 (GA4:GA7=65:35) 668-44-0
Gibberellin 10365-11-4
GIBBERELLIN A3 3-ACETATE 7648-02-4 C21H24O7
GIBBERELLIN A9 METHYL ESTER 2112-08-5 C20H26O4
GIALPHA-1-SUBUNIT, HIS TAG(R), RAT BRAIN, RECOMBINANT, E COLI
GI-ALPHA-3-SUBUNIT, MYRISTOYLATED, RAT
Gialpha-2-Subunit RT-PCR Primer Set and Positive Control
GIALPHA-3-SUBUNITS (AB-5) POLYCLONAL ANTIBODY
GI-ALPHA-2-SUBUNIT, MYRISTOYLATED, RAT
GI-ALPHA-1-SUBUNIT, MYRISTOYLATED, RAT
GI-ALPHA-2-SUBUNIT
GI-ALPHA-3-SUBUNIT, HIS.TAG(R), RAT
GI-ALPHA-2-SUBUNIT, HIS.TAG(R), HUMAN
GI-ALPHA-1-SUBUNIT
Gialpha-1-Subunit RT-PCR Primer Set and Positive Control
GI-ALPHA-1/GQ ALPHA-SUBUNIT CHIMERA, RAT
Gialpha-3-Subunit RT-PCR Primer Set and Positive Control
Gibbsite (Al(OH)3) 14762-49-3
2-GIANIDINOTHIAZOLE-4-METHYLTHIOL 95853-51-3 C5H8N4S2
GiantKnolweedExtract
GIANT TYPHONIUM RHIZOME P.E.
Giant-size molecular model components
Giant Knotweed Rhizome P.E.
GiantKnotweedExtract
GIANTGOURAMI(OSPHRONEMUSGORAMY),MABANTI-:ELISA
GIANT CELL TUMOR, GRADE I-II TISSUE SECTIONS, HUMAN
GIBERELIC ACID
Giberillin Acid
Giardia ELISA
GiardiaLamblia
GIARDIALAMBLIA,SHEEPANTI-
Gia-2-Sub,IB Std.
Gia-2-Sub,His*Tag,Recom.
Gia-2-Sub,Myristoy,Recom
Gia-1-Sub,Myristoy,Recom
Gia-1 & 2-Sub, BP
Gia-3-Sub,Myristoy,Recom
Gia-1-Subunit,IB Std.
Gia-1-Sub, His*Tag,Recom.
Gia-3-Subunit, BP
gidazepam 129186-29-4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96

Copyright 2007©  ChemicalBook. All rights reserved.