ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
5'-GCCGCCGTGGCCGCCTCTAC-3', SODIUM SALT
5'-GCCGCCGCCGCCGCCAT-3'5'-GGAGGACGCTGCGAGTGTT-3', SODIUM SALT
GCCGGC, 5'-PHOSPHORYLATED C57H74N24O43P6
GCCGGC, 5'-NON-PHOSPHORYLATED C57H73N24O40P5
18GA WIRE-BLACK
18GA WIRE-ORANGE
18GA WIRE-RED
GAWK [20-38]
GA100 8X10IN 50/PK
GA55 8X10IN 100/PK
18GA X 650MM 1 M6X1 FTG
12GA X 650MM 1 M6X1 FTG
18GA X 650MM, M6X1, TP, MLM
18GA X 900MM, M6X1
22GA X 650MM 1 M6X1 FTG
12GA X 762MM 1/4 X 28 NT (SR)
24GA X 650MM 1 M6X1 FTG
12GA X 650MM, M6X1 TP (SR)
18GA X 90MM, 3PK NO HUB
12GA X 762MM 1/4 X 28 TP (SR)
18GA X 900MM, M6X1, 3PK
18GA X 650MM, M6X1 NT (SR)
GBP C120H178N34O37S3
GAYLUSACCIA BACCATA EXTRACT
22GA X 24" 1 1/4X28 FTG
12GA X 24" 1 1/4X28 FTG
18GA X 24" 1-1/4X28 FTG
18 GA X 30" 1/4 X 28 NT )SR)
G3BP (full length)
GCGAGCTCGC, 5'-PHOSPHORYLATED
GCGAGCTCGC, 5'-NON-PHOSPHORYLATED
5'-GCGCTCGGCCGCCTGGAACATGGC-3', SODIUM SALT
GCGGCCGC, 5'-PHOSPHORYLATED C76H98N32O57P8
GCGGCCGC, 5'-NON-PHOSPHORYLATED C76H97N32O54P7
GCGGTACCGC, 5'-NON-PHOSPHORYLATED
GCGGTACCGC, 5'-PHOSPHORYLATED
GC-GLOBULIN,VITAMIND-BINDINGPROTEIN,CLONE:249-02,MABANTI-HUMAN:ELISA/WB
GC-GLOBULIN,RABBITANTI-HUMAN
GC-GLOBULIN,VITAMIND-BINDINGPROTEIN,CLONE:249-10,MABANTI-HUMAN:ELISA/WB
GC-GLOBULIN,VITAMIND-BINDINGPROTEIN,CLONE:249-05,MABANTI-HUMAN:ELISA
G 33679-d6 C19H18D6N2O
GD 094 19729-83-0
G-CHLORO-P-ETHYL-BUTYROPHENONE C12H15ClO
G-BROMOHEXANOIC ACID
GC III ELUTION SOLUTION
Gb-3-Sub,His*Tag,Recomb.
Gb-2-Sub,His*Tag,Recomb.
Gb-5-Sub,His*Tag,Recomb.
GD1A-GANGLIOSIDE,IV3NEUAC,II3NEUAC-GGOSE4CER
GCLE 127431-38-3
GCLE 104146-10-3 C24H23ClN2O5S
GCK, N-TERMINAL (1-14) BLOCKING PEPTIDE, HUMAN C73H125N25O26S2
GD1B-GANGLIOSIDE,II3(NEUAC)2-GGOSE4CER
GCLH 64308-63-0 C29H25ClN2O4S
G-BUTYROLACTONE-5,5-D2 C4H4D2O2
GC/MS CALIBRATION AND TUNING MIX 23
GC-MS Inlet Jet Separator
GDF-8
Gd-Dtpa-hpdp 133019-01-9
g-Dendrotoxin, K+ Channel Blocker
g-Dendrotoxin, Dendroaspis angusticeps
GDF-11, HUMAN
GDF-8 HUMAN
GDF-3, HUMAN
GCP-2, HUMAN
GCP 2, Human (Chemokine (CXC motif) ligand 6, Chemokine alpha 3, CKA3, CXCL6, Granulocyte chemotactic protein 2, SCYB6, Small inducible cytokine subfamily B (Cys X Cys) member 6)
GD3-GANGLIOSIDE,II3(NEUAC)2-LACCER
GD2-GANGLIOSIDE 65988-71-8 C72H126N4O34
GD2-GANGLIOSIDE,II3(NEUAC)2-GGOSE3CER
G-DEX (For Blood) Genomic DNA Extracton kit
G-DEX (For Cell/Tissue) Genomic DNA Extracton kit
G-DEX IIb (for Blood) Genomic DNA Extracton kit
G-DEX IIc (Cell/Tissue) Genomic DNA Extracton kit
GDHB 58298-77-4 C11H14N2O5
GDHB(gamma-Glutaminyl-3,4-dihydroxybenzene)
GDHB(RG)
G-D-GLUTAMYLAMINOMETHYLPHOSPHONIC ACID 90632-40-9 C6H13N2O6P
GE500 118549-88-5
68GE Ge
GC1QR,MABANTI-HUMAN:CLONE:60.11,MOUSEIGG1K,FITC
GC1QR,MABANTI-HUMAN:CLONE:60.11,MOUSEIGG1K,BIOTIN
GC1QR,MABANTI-HUMAN:CLONE:74.5.2,MOUSEIGG1K,PE
GC1QR,MABANTI-HUMAN:CLONE:74.5.2,MOUSEIGG1K
GC1QR,MABANTI-HUMAN:CLONE:60.11,MOUSEIGG1K
g-(24-dichlorophenoxy)butyriccid 60210-83-5
G-CSF PRIMER
GCS (glucosylceramide synthase, GCS)
GCTAGAGTAAGTAGTT
G-Dimethylbutylrolactone C6H10O2
2.36g Diminazene Diaceturate Injectable powder
GC Snap Top caps, polypropylene, 11 mm
GCTCTAGAGC, 5'-NON-PHOSPHORYLATED
GCTCTAGAGC, 5'-PHOSPHORYLATED
5' GCTGAGACGGCTATGAAATTC 3'
GCTGCAGC, 5'-NON-PHOSPHORYLATED C77H98N31O53P7
GCTGCAGC, 5'-PHOSPHORYLATED C77H99N31O56P8
5'-GCTGCTCCAATGACAGAG-3', SODIUM SALT
GEA 857 120493-42-7
G-418 DISULPHATE
G 418 DISULFATE SALT C20H44N4O18S2
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87

Copyright 2007©  ChemicalBook. All rights reserved.