ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
GABA Receptor A, gamma 2, CT (Gamma-aminobutyric Acid Receptor Type A gamma 2 Subunit, GABRAg2)
GABA Receptor A, gamma 3 (Gamma-aminobutyric Acid Receptor Type A gamma 2 Subunit, GABRAg2)
GABA Receptor A, alpha 1 (Gamma-aminobutyric Acid Receptor Type A alpha 1 Subunit, GABRA1)
GABA Receptor A, alpha 6, Rat (Gamma- aminobutyric Acid Receptor Type A alpha 6 Subunit, GABRA6) Control Peptide
GABA Receptor B 2 (GBR2)
GABA Receptor A, beta 2, CT (Gamma-aminobutyric Acid Receptor Type A beta 2 Subunit, GABRAb2)
GABA Receptor A, gamma2 (Gamma-aminobutyric Acid Receptor Type A gamma Subunit, GABRA)
GABA Receptor A, alpha (Gamma-aminobutyric Acid Receptor Type A alpha Subunit, GABRA)
GABA Receptor A, gamma2, Cyto loop
GABA Receptor A, alpha 3 (Gamma-aminobutyric Acid Receptor Type A alpha 3 Subunit, GABRA3)
GABA Receptor B 1b (GBR1b)
GabaRiceGerm
GABA Receptor B 1b, Rat (GBR1b) Control Peptide
GABA Receptor Associated Protein, Human (GABARAP) Control Peptide
GABA Receptor A, beta 2, Cyto loop
GABA Rabbit Polyclonal
GABASE
GABA Transporter 3 (GAT-3, (Gamma aminobutyrIc acid)
GABA Transporter 1 (GAT-1, Gamma aminobutyrIc acid)
GABA Transporter 1, Rat (GAT-1, Gamma aminobutyrIc acid) Control Peptide
GABA Transporter 2, Rat (GAT-2, Rat (Gamma aminobutyrIc acid) (Control Peptide)
GABA TRANSPORTER-2, RAT, 15AA NEAR CT
GABA Transporter 2 (GAT-2 (Gamma aminobutyrIc acid)
GABA TRANSPORTER-1, RAT, 19AA INTERNAL DOMAIN
GABA Transporter 1 (GAT-1, (Gamma aminobutyric Acid Transporter 1)
GABA TRANSPORTER-3, RAT, 15AA NEAR CT
GABA Transporter 3, Rat (GAT-3, Rat (Gamma aminobutyrIc acid) Control Peptide
GabbotMethyleneBlueSolution
Gab1 CT (Grb2-Associated Binder1)
GabexateMesilate,EnzymeInhibitor
Gabexate
GABEXATE 39492-01-8 C16H23N3O4
Gabexate mesylate 56974-61-9 C17H27N3O7S
GABEXATE MESILATE WS/JP
GAA6, RAT, 13AA NEAR NT
GAA1, RAT, 14AA NEAR NT
Gab1 (Grb2-Associated Binder1) (BSA & Azide Free)
Gab2 (Grb2-Associated Binder)
Gab1 (Grb2-Associated Binder1)
Gab1 (Grb2-Associated Binder1) A
GACAGCTTATCATCG
5' GAATTTCATAGCCGTCTCAGC 3'
Gabmtp 14997-54-7
GABOON VIPER VENOM
Gab2, Phosphorylated (Grb2-Associated Binder2) (Tyr452)
Gab1, phosphorylated (Grb2-Associated Binder1) (Tyr307)
Gab1, phosphorylated (Tyr627) (Grb2-Associated Binder1)
Gab1, phosphorylated (Grb2-Associated Binder1) (Tyr627)
GACGCGTC, 5'-PHOSPHORYLATED C77H99N31O56P8
GACGCGTC, 5'-NON-PHOSPHORYLATED C77H98N31O53P7
GAB2, RAT, 12AA NEAR CT
GAD153
GAD67
GAD 65 [4-17]
GAD Antibody
GAD-65, anti EIA(Standard Range: 0.85)
GAD65 (B96) Human Monoclonal
GAD65 (B78) Human Monoclonal
GADD153,HUMAN,RECOMBINANT
GADD-153 PRIMER
Gaby-Hadley Reagent A (1 a naphthol in 95 ethanol)
GABY-HADLEY REAGENT A
GABY-HADLEY REAGENT B
GADFLY PLANT EXTRACT
GAD-65 (glutamate decarboxylase)
GAD 65 (5-22) (Glutamic Acid Decarboxylase), Rabbit anti-
GAD 65 (514-530) (Glutamic Acid Decarboxylase), Rabbit anti-
GAD 571-585, GLU 579, HUMAN 67/65 KD ISOFORM
GAD 65 (Glutamate Decarboxylase 65), C-terminal, 65kD, Rabbit anti-Human, Rat, paraffin, IH
GAD 65/67 (Glutamic Acid Decarboxylase), Rabbit anti-
GAD65 (Glutamate Decarboxylase 65)
gAcrp30, Recombinant Variant, Human (Globular Adipocyte Complement-related Protein of 30kD, apm-1, Adipolean)
gAcrp30, Recombinant, Human (Globular Adipocyte Complement-related Protein of 30kD, apm-1, Adipolean)
gAcrp30, Recombinant, Murine (Globular Adipocyte Complement-related Protein of 30kD, apm-1, Adipolean)
gAcrp30, Recombinant Western Blot Control (Globular Adipocyte Complement-related Protein of 30kD, apm-1, Adipolean)
gAcrp 30, Mouse recombinant
gAcrp30 (Globular Adipocyte Complement-related Protein of 30kD, apm-1, Adipolean)
GACRP30, MOUSE
GACTAGTC, 5'-PHOSPHORYLATED C78H100N30O55P8
GACTAGTC, 5'-NON-PHOSPHORYLATED C78H99N30O52P7
GAD 516-528, HUMAN 65 KD ISOFORM
GAD 8-20, HUMAN 65 KD ISOFORM
GAD 65/67, ~65 & 76kD, Clone: 9A6, Mab anti-Human, Mouse, Rat, , WB/IHC
GAD67, MOUSE, 18AA NEAR NT
GADOBENATE DIMEGLUMINE 127000-20-8
Gadobutrol 138071-82-6 C18H31GdN4O9
Gacyclidine 68134-81-6
GADODIAMIDE RELATED COMPOUND B GADOLINIUM DISODIUM DIETHYLENETRIAMINE PENTAACETIC ACID USP(CRM STANDARD)
Gadodiamide 131410-48-5 C16H26GdN5O8
GADODIAMIDE RELATED COMPOUND A GADOLINIUM SODIUM DIETHYLENETRIAMINE PENTAACETIC ACID MONOMETHYLAMIDE USP(CRM STANDARD)
GADODIAMIDE USP(CRM STANDARD)
GADOLINIUM 2,4-PENTANEDIONATE, TRIHYDRATE C15H27GdO9
GADOLINIUM (III) ACETATE HYDRATE 100587-93-7 C6H11GdO7
GADOLINIUM BROMIDE 13818-75-2 Br3Gd
gadolinium-1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetrakis(methylenephosphonic acid) 120721-77-9
GADOLINIUM (III) ISOPROPOXIDE 14532-05-9 C9H21GdO3
GadoliniumMetalAndOxide
GADOLINIUM BORIDE 12008-06-9 BGd
GADOLINIUM SELENIDE Gd2Se3
GADOLINIUM FLUORIDE 13765-26-9 F3Gd
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72

Copyright 2007©  ChemicalBook. All rights reserved.