ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
DEXTRAN, DMNB-CAGED FLUORESCEIN
Dextran 500¦Ì000 Fluorescein isothiocyanate Conjugate
D-Glucose monohydrate 5996-10-1 C6H14O7
DEXTROMETHORPHAN TANNATE
DEXTRAN POLYALDEHYDE
DEXTRAN, OREGON GREEN(TM) 514
DEXTRAN, ALEXA FLUOR(R) 594
DEXTROSE CASEINPEPTONE AGAR
DEXTRANBOUND ACETAZOLAMIDE
Dextran - 70 (BP)
Dextran standard 270,000
Dextrose 100 vegetable peptones Agar C6H12O6
Dextranase (HRP)
DEXTROSE CASEIN PEPTONE AGAR (APHA)
Dextrose Salt Broth
DextroseAnhyInjection
Dextrin 9004-53-9 (C6H10O5)n
DEXTRAN, TETRAMETHYLRHODAMINE
DEXTRAN, BIOTIN AND LYSINE LABELED
DEXTRATES,HYDRATED,NF
Dextran D-10 £¨C6H10O5£©n
Dextromethorphan-d3 HBr C18H22D3NO.HBr
DEXTROSE 492-62-6 C6H12O6
DEXTRAN, BCECF
DEXTRAN RED
DEXTRAN, DMNB-CAGED FLUORESCEIN AND BIOTIN
DEXTRAN, OREGON GREEN(TM) 488
DEXTRO-CAMPHORIC O-TOLUIDIDE C17H23NO3
DEXTRAN CARBOXYL, [CARBOXYL-14C]-
DEXTRAN, CASCADE BLUE(R)
DEXTRAN, SNARF(R)-1
dextrofemine 15687-08-8 C18H23NO
DEXTRIN LAURATE 79748-56-4
DEXTRAN, ALEXA FLUOR(R) 568
DEXTROSE TRYPTONE AGAR
DEXTRORPHAN D-TARTRATE 125-73-5 C21H29NO7
DEXTRORPHAN-O-GLUCURONIDE C23H31NO7
DEXTROSE ANHYDROUS INJ C6H12O6
dextro-1,3,3-TRIMETHYLBICYCLO[2.2.2]-2-HEPTANONE
DextrinPotato
DEXTROSE,FCC(BULK
Dextrophan-d3 tartrate C17H20NOD3.C4H6O6
DEXTROSE, LOW ENDOTOXIN C6H12O6
DEXTRAN MERCAPTOSUCCINATE
DEXTRAN EPOXIDE
DEXTRIN BEHENATE 112444-74-3
Dextrose Tryptone Agar (Powder)
DEXTRAN M.W. 2,000,000 Mw/Mn 11.6
Dextrose Peptone Agar
DextroseAnhydrousDextroseMonohydrate
Dextrins,Yellow
DEXTRAN, 5-(AND-6)-CARBOXY-Q-RHODAMINE, CMNCBZ-CAGED
DEXTRAN HYDRAZIDE
DEXTRAN CROSS-LINKED G-25
DEXTRAN SULFATE, [CARBOXYL-14C]
DEXTRAN CROSS-LINKED G-50
DEXTRAN [3H]
DEXTRIN SULFATE
Dezam 77907-43-8
(3,3,4,4,4-D5)-(E/Z)-1-[4-(2-CHLOROETHOXY)PHENYL]-1-[4-(T-BUTYLDIMETHYLSILYLOXY)PHENYL]-2-PHENYL-1-BUTENE C30H32ClD5O2Si
(3,3,4,4,4-D5)-(E/Z)-1-[4-(2-CHLOROETHOXY)PHENYL]-1-[4-HYDROXYPHENYL]-2-PHENYL-1-BUTENE C24H18ClD5O2
(3,3,4,4,4-D5)-(E/Z)-1-[4-(2-Chloroethoxy)phenyl]-1-[4-hydroxyphenyl]-2-phenyl-1-butene 78995-98-9 C5H5D5Cl2O2
(3,3,4,4,4-D5)-(E/Z)-1-[4-(2-Chloroethoxy)phenyl]-1-[4-(t-butyldimethylsilyloxy)phenyl]-2-phenyl-1-butene C30H32D5ClO2Si
-D-GENTIOBIOSE extrapure for biochemistry
DGENTA C14H22N4O10
Dexylosylbenanomicin B 128110-33-8
Dexylosylbenanomicin A 133806-62-9
(+/-)-D5-GEOSMIN C12H17D5O
D-(-)-FORMYLOXY-PHENYL-ACETIC ACID
DFormAminoAcids
Dezinamide
dezinamide 91077-32-6
DFPLNH 64309-01-9 C52H88N2O39
Dezocine 53648-55-8 C16H23NO
Dezocine Hydrobromide
5'-D(GGGCAGGG)-3, SODIUM SALT
5'-D[GGGCTGGCAAGCCACGTTTGGTG]-3'
1-(5-Dezoxy-1,2-isopropylidene-alfa-D-xylofuranose-5-yl)-(R/S)- piperidine-3-carboxylic acid ethyl ester
DGGKDTDTNDTEIFR C68H106N20O30
2,4-D-FRESHKEPPINGAGENT
DH 97 343263-95-6 C22H26N2O
D-Friedoolean-14-en-3beta-ol 22076-46-6
D(GGTGGCGACGACTCCTGGAGCCCG) 139528-83-9
dG(ib) CPG
dG(ib) CPG 1000
dG(ib) CPG 500
dG(ib) Phosphoramidite
DG(IB) PHOSPHORAMIDITE DG(IB)
DG(IBU) PHOSPHORAMIDITES
DG(IBU) DERIVATIZED CPG
D-FRUCTOSE-6 6-D2 285979-75-1 C6H10D2O6
D-FRUCTOSE-6-PHOSPHATE BARIUM SALT 6035-54-7 C6H11BaO9P
D-FRUCTOSE (U-13C6, 99)
D-Fructose-1,6-diphosphate trisodium salt octahydrate 81028-91-3 C6H27Na3O20P2
D-FRUCTOSE-1,6-DIPHOSPHATE DIBARIUM SALT extrapure
D-(-)-FRUCTOSE C6H12O6
D-FRUCTOSE, [U-14C] C6H12O6
D-FRUCTOSE-6-PHOSPHATE, DISODIUM SALT, [14C(U)]- 250-350 MCI(9.25-12.95 GBQ)/MMOL, DELIVERED >= 95 PURE WITH HPLC RADIOCHROMATOGRAM
D-Fructose, 1,3,6-trideoxy-3,6-epithio- (9CI) 55780-98-8 C6H10O3S
D-Fructose-6,6'-2H2
35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

Copyright 2007©  ChemicalBook. All rights reserved.