ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
DEUTERIUM IODIDE 14104-45-1 DI
DEUTERATED POLY(ETHYLENE OXIDE)
DEUTERATED POLYSTYRENE-B-POLY(METHYL METHACRYLATE)
DEUTERIUM LAMP FOR WATERS M480 & M481, EA
DEUTEROPORPHYRIN IX 2-VINYL, 4-HYDROXYMETHYL C33H34N4O5
DEUTERO-METHOXYAMINE-D3 HCL 110220-55-8 CH3ClD3NO
DEUTERIUM FLUORIDE DF
DEUTEROPORPHYRIN IX DIHYDROCHLORIDE 448-65-7 C30H30N4O4
DEUTERATED MOLECULAR SIEVES 3A
DEUTERIUM SULFIDE 13536-94-2 D2S
DEUTERATED POLY(N-ISOPROPYL ACRYLAMIDE)
3,4-Dfma 103692-53-1
D(GCAATTTAACTGTGAT) 81412-70-6
DG-C8-ABP C22H22N6O4
DG-C8-ABP-D5 C22H17D5N6O4
Deutolperisone 474641-19-5
DEV LACTOSE PEPTONE BROTH (DIN)
DEV LACTOSE BROTH
DEV LACTOSE PEPTONE BROTH
Dewar 35L Accessories
DEWAR FLASK, STYLE B, I.D. 17CM, DEPTH 1 3.5CM
5'-D (GCCAGGGTTTTCCCAGTCACGA) -3'
DEWAX
DEWAXING CATALYST
DFLNNH 115236-57-2 C52H88N2O39
DEV NUTRIENT GELATIN
DEV NUTRIENT AGAR (DIN)
DEV NUTRIENT AGAR
3'-DG CEP 196391-62-5 C43H53N8O7P
5'-D (GCGCGAAATTAACCCTCACTAAAG) -3'
DEWFRUIT
DEVRINOL, 250MG, NEAT
DEV TRYPTOPHAN BROTH
DEXAMETHASONE, [1,2,4-3H(N)] C22H26FO5T3
DEXAMETHASONE ISONICOTINATE 2265-64-7 C28H32FNO6
Dexamethasone (10 mM)
Dexamethasone palmitate 14899-36-6 C38H59FO6
Dexamethasone 21-O-b-D-galactopyranose
Dexamphetamine Tartrate
Dexamethasone Sodium Phosphate, Powder
Dexamethasone acetate micro
Dexamethasone base&salts
DEXAMETHASONE ASSAY STANDARD BP(CRM STANDARD)
Dexamethasone21
DEXAMETHASONE-WATER SOLUBLE CELLCULTURE TESTED
Dexamethasone sodium phosphate 55203-24-2 C22H28FNa2O8P
Dexamethasone, Rabbit anti-
DEXAMETHASONE SODIUM PHOSPHATE IMP. A (EP): DEXAMETHASONE MM(CRM STANDARD)
DexamethasoneSodiumPhosphateInjection
Dexamethasone 21-phosphate disodium salt 2392-39-4 C22H28FNa2O8P
DEXAMETHASONE, [6,7-3H(N)] C22H25FO5T4
DEXAMETHASONE HEMISUCCINATE 3800-86-0 C26H33FO8
DEXAMETHASONE SODIUM PHOSPHATE 312-93-6 C22H30FO8P
DEXAMETHASONE MESYLATE C23H31FO7S
Dexamethasone inter.
Dexamethasone &salts
DEXAMETHASONE PHOSPHATE BP STANDARD(CRM STANDARD)
DEXAMETHASONE(REAGENT / STANDARD GRADE)
DexamethasoneSodiumPhosphate-Bp/Ep/Usp/Ip
DexamethasoneInjection
DexamethasoneAcetateIp/Bp/Usp
Dexamethasone-4,6¦Á,21,21-D4
Dexamethasone, Micronized
Dexamethasone, ELISA Kit (a 5 kit minimum)(Standard Range: sensit. down to abt. 0.5 ng/ml)
DEXAMETHASONE PIVALATE EPD(CRM STANDARD)
Dexamethasone b-D-Glucuronide 152154-28-4 C28H37FO11
DEXAMETHASONE 21-O-BETA-D-GALACTOPYRANOSIDE 319426-57-8 C28H40O10
DEXAMETHASONE CELL CULTURE REAGENT CRYSTALLINE
DexamethasoneSodiumPhosphateBp93
Dexamethasone21SodiumPhosphate
DEXAMETHASONE PIVLATE C37H53FO8
Dexamethasone 21-(sodium hydrogen phosphate) 1869-92-7 C22H30FO8P.Na
DexamethasoneAcetate&Base&Sodium
Dexamfetamine
dexamethasone 21-methanesulfonate 2265-22-7
DexamethasoneSodium
DEXAMETHASONE PHOSPORIC ACID WHO(CRM STANDARD)
DexamethasoneBaseBp/Usp
DEXAMETHASONE MESYLATE, [6,7-3H(N)] C23H27FO7ST4
Dexamethasone 50-02-2 C22H29FO5
DEXAMETHASONE 21-O-?-D-GALACTOPYRANOSIDE C27H37O10F
DEXAMETHASONE FLUORESCEIN C42H41FO10
DEXAMETHASONE 21-PHOSPHATE
dexamisole 14769-74-5 C11H12N2S
Dexamethasone Base/Acetate
DEXAMETHASONE B.P
Dexamethasone dipropionate/valerate/sodium phosphate
Dexamethasone, Immunoaffinity Chromatography Gel
DEXAMETHASONE DIPROPIONATE C28H37FO7
Dexamethasone-17-acetate 1177-87-3 C24H31FO6
DEXAMETHASONE-4,6ALPHA,21,21-D4 C22H24D5FO5
Dexamethasone Sodium Phosphate USP 23
DEXAMETHASONE WATER SOLUBLE C22H30O4
Dexamethasone palmitate 80950-33-0
DEXAMETHASONE CELL CULTURE REAGENT GAMMA-IRRADIATED CRYSTALLINE
DEXAMETHASONE SODIUM PHOSPHATE IMP. B (EP): BETAMETHASONE SODIUM PHOSPHATE MM(CRM STANDARD)
DexamethasoneAcefurate
DEXAMETHASONE ACETATE, MONOHYDRATE 55812-90-3
DEXANABINOL C25H38O3
D-4-(FLUOROPHENYL)ANALINE
32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132

Copyright 2007©  ChemicalBook. All rights reserved.