ChemicalBook

A
B
C
D
E
F
G
H
I
J
K
L
M
N
O
P
Q
R
S
T
U
V
W
X
Y
Z

Description CAS Number Molecular Formula
D5-ETHYL BENZOYLFORMATE C10H5D5O3
D-3-ETHYLNORVALINE C7H15NO2
DESTHIOBIOTIN PEO IODOACETAMIDE C21H38I1N5O6
DESTHIOBIOTIN-X C2-IODOACETAMIDE C20H36IN5O4
DESTHIOBIOTIN-X ETHYLENEDIAMINE, HYDROCHLORIDE C18H36ClN5O3
(DES-THR7)-GLUCAGON C149H218N42O47S
(DES-THR5)-GLUCAGON C149H218N42O47S
DESTHIAZOLYMETHYLRITONAVIR C33H45N5O5S
DESTHIOBIOTIN-TEG CPG
DESTHIOBIOTIN N-HYDROXYSUCCINIMIDYL ESTER 80750-24-9 C14H21N3O5
Detirelix 89662-30-6
DESTHIOBIOTIN-TEG CEP C52H78N5O11P
destomycin A 14918-35-5 C20H37N3O13
Destomic Aldehyde C7H15NO6
DESTOMICIN A C20H37N3O13
Destruxin E1 5 79385-96-9
DESTRUXIN A 6686-70-0 C29H47N5O7
DES-1-TRYPTOPHAN-(12-LEUCINE)MINI GASTR 66009-14-1 C75H101N15O26
DESTREAK REAGENT
D-1,3,5(10), 6,8-ESTRAPENTAEN-3-OL-17-ONE BENZOATE C25H22O3
D-1,3,5(10), 6,8-ESTRAPENTAEN-3-OL-17-ONE METHYL ETHER C19H20O2
DESTREAK REHYDRATION SOLUTION
15-Des-trp-phe-gramicidin A 65284-03-9
D-1,3,5(10), 6,8-ESTRAPENTAEN-3-OL-17-ONE BENZYL ETHER C25H24O2
D-1,3,5(10), 6,8-ESTRAPENTAEN-3-OL-17-ONE ETHYL ETHER C20H22O2
DESTRUXIN CHL 121723-07-7 C29H48ClN5O8
DESULFO COENZYME A 5863-40-1 C21H36N7O16P3
DesulfurizationAgent
Desulfurizer
(DES-TYR1)-MET-ENKEPHALIN 61370-88-5 C18H26N4O5S
(DES-TYR1)-LEU-ENKEPHALIN 60254-83-3 C19H28N4O5
DES-TYR-1-LEUCINE ENKEPHALIN ACETATE 88492-45-9 C19H28N4O5
DES-TYR1-METHIONINE ENKEPHALINAMIDE ACETATE SALT 100929-59-7 C20H31N5O6S
Desvenlafaxine succinate 386750-22-7 C16H25NO2.C4H6O4.H2O
[DES-TYR1 ]-BETA-CASOMORPHIN 100900-41-2
DES-TYR-1-METHIONINE ENKEPHALIN ACETATE 94825-43-1
DES-TYR1-LEUCINE ENKEPHALINAMIDE ACETATE SALT 100929-57-5 C21H33N5O6
DET-O-JET LIQUID DETERGENT
DET-O-JET(R)
DESYL CHLORIDE 447-31-4 C14H11ClO
DESYL BENZOATE 1459-20-7 C21H16O3
Detomidine BASE or HCL
Detomidine hydrochloride 90038-01-0 C12H15ClN2
detomide hck/detomidine
Detorubicin 66211-92-5
DG 18 AGAR
5'-D (GAGCGGATAACAATTTCACACAGG) -3'
Detoxification kit for ethidium bromide/SYBR(R) green
DETOXI-GEL
DETOXIFIED LIPID A (SALMONELLA MINNESOTA, R595 DERIVED)
Detoxificant
Detralfate 37209-31-7
DETRITYLATION REAGENT
DETRITYLATION-SOLUTION
DETRITYLATION - SOLUTION DNA SYNTHESIS GRADE
Dettox 101839-71-8
D-Galactosamine-6-O-sulphate 20257-10-7
D-GALACTOSAMINE X HCL, TLC 1172-03-8
D-Galactose-2-D2
2-(D-GALACTO-PENTYLHYDROXYPENTYL)-4(R)-1,3-THIAZOLIDINE-4-CARBOXYLIC ACID 124650-46-0
D-Galactose, 2-(acetylamino)-2-deoxy-3,4,5,6-tetrakis-O-(trimethylsily l)- 55721-25-0
D-GALACTONO-1,4-LACTONE 2782-07-2 C6H10O6
D-GALACTOSE, [1-14C] C6H12O6
D-GALACTOSE-4-O-SULPHATE (NA+) C6H12O9S
D-GALACTAMINE C6H15NO5
D-Galactopyranose pentaacetate 25878-60-8 C16H22O11
D-GALACTOSAMINE-2-N-SULFATE, SODIUM SALT 157297-00-2 C6H12NNaO8S
D-GALACTURONIC ACID SODIUM SALT C6H9NaO7
D-GALACTAL CYCLIC 3 4-CARBONATE 149847-26-7 C7H8O5
¦¢-D-GALACTOSE PENTAACETATE C16H22O11
D-GALACTOSE-4-SULFATE, SODIUM SALT 125113-68-0 C6H11NaO9S
D-GALACTOSE-6-SULFATE, SODIUM SALT 125455-62-1 C6H11NaO9S
D-GALACTOSE DIETHYLDITHIOACETAL 5463-33-2 C10H22O5S2
D-GALACTURONIC ACID 14984-39-5 C6H9Na1O7
D-GALACTOSE, [6-3H](N)]-, DELIVERED >= 96 PURE 129521-70-6
D-GALACTOSE-1-D 64267-73-8 C6H11DO6
D-GALACTOSE, [U-14C] C6H12O6
D-Galactosamine-2-N-sulphate 481635-18-1
¦Á-D-Galactopyranose 1,2-(Methyl Orthoacetate) C9H16O7
D-Galactitol, 1-(acetylamino)-6-amino-2,5:3,4-dianhydro-1,6-dideoxy- (9CI) 790613-25-1 C8H14N2O3
D-(+)-GALACTOSE 10257-28-0 C6H12O6
8-(-D-Galactopyranoside)-octanoic AcidDiscontinued C14H26O8
D-Galactitol, 2-amino-1,2,4-trideoxy-1,4-imino- (9CI) 53403-37-5 C6H14N2O3
D-Galactonic acid 576-36-3 C6H12O7
D -(+) - GALACTOSE MIN
D-Galactose 59-23-4 C6H12O6
¦Á-D-Galactose-1-phosphate dipotassium salt C6H11K2O9P.5H2O
D-Galactitol, 2-amino-3,6-anhydro-1,2-dideoxy- (9CI) 685083-91-4 C6H13NO3
D-Galactosamine-1-phosphate 41588-64-1
d-Galactose, dinonyl mercaptal 123389-88-8
D-GALACTOSE 1-[2-(2-AZIDOETHOXY)ETHOXYETHYL]-2,3,4,6-TETRA-O-ACETATE 381716-33-2 C20H31N3O11
D-GALACTURONIC ACID 685-73-4 C6H10O7
D-Galactitol-1-13C
D-Galactose, 2-(acetylamino)-2-deoxy-, homopolymer 78393-48-3
D-GALACTOSE PYROGEN FREE
D-GALACTOSAMINE 7535-00-4 C6H13NO5
D-GALACTOSE-1-PHOSPHATE, [U-14C] DISODIUM SALT C6H11Na2O9P
D-Galactose-6-phosphate disodium salt 32972-52-4 C6H11Na2O9P
D-(-)-galactonic acid-¦Ã-lactone C6H10O6
D(+)-Galactosamine hydrochloride 1772-03-8 C6H14ClNO5
30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

Copyright 2007©  ChemicalBook. All rights reserved.