ChemicalBook

AACCCCTCAAGACCCGTTTA Product Description

AACCCCTCAAGACCCGTTTA Structure
CAS No.
Chemical Name:AACCCCTCAAGACCCGTTTA
CBNumber:CB4769774
Molecular Formula:
Formula Weight:0
MOL File:Mol file
AACCCCTCAAGACCCGTTTA Synonyms:

AACCCCTCAAGACCCGTTTA
T7SELECTDOWN PRIMER
T7SELECT(R)DOWN PRIMER

AACCCCTCAAGACCCGTTTA Property

Safety
AACCCCTCAAGACCCGTTTA Suppliers      Global( 3)Suppliers     
SupplierTelFaxEmailCountryProdListAdvantage
Beijing TianLi Biological Chemical Co., Ltd. 01086181995 01089124423 waley188@sohu.comCHINA 44232 47
VWR International 800 932 5000610 436 1761solutions@vwr.comUNITED KINGDOM 30847 82
EMD Biosciences, Inc. 800 526-7319608 238-1388novatech@novagen.comUSA 610 77
 
AACCCCTCAAGACCCGTTTA Related Search:
AACCCCTCAAGACCCGTTTA T7SELECTDOWN PRIMER T7SELECT(R)DOWN PRIMER
Copyright 2007 © ChemicalBook. All rights reserved